genoma.unsam.edu.ar :: tca :: tca-05j15.b1

Sequence

>tca-05j15.b1
CCACGCGTCCTACGGTTGTTCCCGCCAAGACTAGCCCCAAGCCGGACCCACATGAGAACT
CCTCTGTTGTGTTTGTTTCGCCCATCTTCCGCACCTCCACGACGAGGAAGCAGATCATGG
ATCTCTTCGCGGGCACGAAGGTGCTGCGTCTGCGCACTTACCGCAGCAACCACGCGTACG
TGTACTTCGACTCCGCTGCCACCGCGCAGAAGGTGGTGAAGGAGAAGAACGGCACTGAGT
TCCGTGGCAAGAAGCTCCGTGTGGCACTCTCTACCCGCTCCCTCGCGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAB81432.1| (AF020695) RNA binding protein [Trypanosoma brucei]   Goto GenBank  
Score: 164  Expect: 7e-40
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2594  coding