genoma.unsam.edu.ar :: tca :: tca-05j24.b1

Sequence

>tca-05j24.b1
CCACGCGTCCGTGACCGCTACGGTGTGGCGCGTTTGTGGGACCTCAATCAGGGCGAGGCA
CTTTGGGAACTCTCTGCCGGATCTCCCATCAACCAGATTTGCTTCTCCCCGAACCGCTAC
TGGATGTGTGCCGCGACTGAGAAGGCTATTCGCATCTTCGATCTTGAGAGCAAGGACGTG
ATTGTGGAACTTGTTCCGGAGACGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q94775|GBLP_TRYBB GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT-LIKE PROTEIN (ACTIVATED PROTEIN KINASE C RECEPTOR HOMOLOG) (TRACK)   Goto Swissprot  
Score: 117  Expect: 9e-38
nr  BLAST report  
gb|AAC72849.1| (AF100286) activated protein kinase C receptor homolog [Trypanosoma congolense]   Goto GenBank  
Score: 119  Expect: 9e-38
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0471  coding