genoma.unsam.edu.ar :: tca :: tca-05k5.b1

Sequence

>tca-05k5.b1
CACGCGTCCGTGATGATGTCCTGGCATCAGGCGGAACGGCCCTCGCCGGGTTGCAGCTTG
TTGAAGCAAGTGGTGCCACACCTGTTGAGATGGCGTTCGTTATGAACGTTACACCACTCT
CCGGTGCGAAGAACATACATAATTACAAAGATGGCCGATTCAAGAATGTCAAAGTTTTCT
CACTGGTTGAATCCACGTGCCTTGATGATTCAAATTGTGGTGACGTAGTCGACTACGATG
GCCCTCGTGTGATCAGTTGCGAATGTGCGCTTAACAAATTATAAAAATGTTTAGTGCGAA
TACAATATGCTGAATCTTTTTTTTTTTTAAGGAAAGAGTGAAATTTGGGAAAAAAAATTT
TGTGGACGCTAAAAAAAAATTCTGTTTTTTGTTTTCCCCACTCAAAATATTTTTAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC36208.1| (AF060886) adenine phosphoribosyltransferase [Leishmania tarentolae]   Goto GenBank  
Score: 97.1  Expect: 2e-19
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7432  indefinite