genoma.unsam.edu.ar :: tca :: tca-05m15.b1

Sequence

>tca-05m15.b1
TTCCCGGGTCGACCCACGCGTCCGAATTTAATCAATCTTCTTTGTGCTTTTAAGAAAGAG
ATTGGCGAAGGAATTGAGAGCTATCGAGACATTTTGGCTCTTGTTATGTCTAAAACATCT
GTATCGATTCCCGTTCTTTCTTCCTCACTCCAGTATGTTAACGCAATGTTTACACCAATT
TTACAGTACGGTCAGCTTGTATCTTTGCAGAGAGATGTTTTTGGCCGTCATGGATATGAG
CGTCTTGACACGGAGGAAACTGAATCGCATCAGTGGCCTGAATTACAATAGGATCGAAAG
TGTGCGGTTTGCTTCTTTTATATCATTTTTTTTGTTGATTTAAAAAGGAGGAAACAAGCT
A


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P31072|6PGD_TRYBB 6-PHOSPHOGLUCONATE DEHYDROGENASE, DECARBOXYLATING   Goto Swissprot  
Score: 133  Expect: 2e-31
nr  BLAST report  
pir||A48565 phosphogluconate dehydrogenase (decarboxylating) (EC 1.1.1.44) - Trypanosoma brucei   Goto GenBank  
Score: 133  Expect: 1e-30
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8705  indefinite