genoma.unsam.edu.ar :: tca :: tca-05m3.b1

Sequence

>tca-05m3.b1
GAGATTATGAGAAGGAAAAACAATTAGAGGTGTTTTTATTGTATATTTTGATGTTTGGAG
TGTTTTGGTTTTGTGTTTGTTTATTAGTTTATGTTTATTTTTGCTATTATGGTTTATGTT
GTTTGATTTACCATTTTTAATTTTTTGTTATTCTGTTTTTTAAATCCGTATTTGTTGCTA
CATTTATATTGTTTGGTTTGTTGGGTTCTATTTTATTTTTGATTGATTTATTACATTTTA
CACACGTTTTTTTAGGTGTATTCTTATTGTTTATTTGTCTTGGTCGTTTATTTAACTCTT
TGTGTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P14546|COX3_LEITA CYTOCHROME C OXIDASE POLYPEPTIDE III   Goto Swissprot  
Score: 89.0  Expect: 9e-18
nr  BLAST report  
pir||A25877 cytochrome-c oxidase (EC 1.9.3.1) chain III - Crithidia fasciculata mitochondrion (fragment)   Goto GenBank  
Score: 89.7  Expect: 3e-17
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.4949  noncoding