genoma.unsam.edu.ar :: tca :: tca-05m6.b1

Sequence

>tca-05m6.b1
CCACGCGTCCGCTCTCCAGGCTATGGAAAAGTTTAATATTGAAAAGGATATTGCCGCTTA
CATCAAGAAGGAGTTTGATAAGAAATATCAGCCGACATGGCACTGTATCGTGGGCCGGAA
CTTTGGCAGCTATGTAACTCACGAGACGCACAGCTTCCTGTACTTTTATTTTGGACAGGT
TGCGATTCTGCTCTTCAAGTCCGGTTGAGAGTGTGTTAAAGGAAATAAAAAGAAGAAAAC
ATCTGTATAGAGAAAATGGATTCTGTGTGAAAACTAGAAGGCAGCTAAGCGCCACGTCTT
TGCGGACGTGGNCCTCCTACGCACATTCGGGATTCTTTTATAGCCACTTAAAGAACCAAA
ACAAAACAGAAAGAGATGAATGATGAAAACGAGAAAACAGAAGAAACATTTTTATT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O02414|DYL1_ANTCR DYNEIN LIGHT CHAIN LC6, FLAGELLAR OUTER ARM   Goto Swissprot  
Score: 125  Expect: 7e-29
nr  BLAST report  
dbj|BAB27516.1| (AK011284) putative [Mus musculus] gb|AAK57536.1| (AY034383) dynein light chain-2 [Rattus norvegicus] gb|AAH10744.1|AAH10744 (BC010744) Similar to RIKEN cDNA 6720463E02 gene [Homo sapiens] gb|AAH11289.1|AAH11289 (BC011289) RIKEN cDNA 6720463E02 gene [Mus musculus] gb|AAK38749.1| (AY029255) dynein light chain 2 [Mus musculus]   Goto GenBank  
Score: 126  Expect: 3e-28
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8314  indefinite