genoma.unsam.edu.ar :: tca :: tca-05n11.b1

Sequence

>tca-05n11.b1
CCACGCGTCCGCTTTTATTATCTTCTCGCACGCCGTTCATGGGTGGCAATCGGAGTGTTC
CGGCAGTTTCCACCAACAGAGAAGTTGCCAGGTATCCCGCGGTACTTCATCACGAACCCG
TCGCTTAAAATGCCTCTGCGCGCGGACGACGTAATGTATGCGATCTCCGATGTGCCTTCT
CAGCTTAAGAAGAACTGAGATACTGAGAGAGGAGTGGTTTACATGTGGCATACACTCATT
CTTAACTGTTTTCTCCTGCGAATTATTGATACCATTCAATTGTTATTTTGGAGGGTTGAT
GCGCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAB95606.1| (AL359782) CAKC1 [Trypanosoma brucei]   Goto GenBank  
Score: 87.8  Expect: 1e-16
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9435  indefinite