genoma.unsam.edu.ar :: tca :: tca-05n8.b1

Sequence

>tca-05n8.b1
TTTTCGGTCTTCAGGCCGGTGTCGATGGCCAGATGAAATACATATTCTTCAAGAAGGGCG
CAGCAGGTGGGTGCATTTATACATCAAAGCAAACTGCTATTGTGGCAGTGTACCGTACTC
CTGGCGATGCTTCGTCATTGCAACAAGACTTGTAAAAAGCAGGAACAAATGATGTCGCAG
GTAACCCTGCCGACTGCTACTCAACCGTTGAGCGAATTGCTGAATATCTTATTAGTCTGG
AGTACTGAATTATGTGATACCGAGATTGCAAATTATGAGCTCTAAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q26734|PROF_TRYBB PROFILIN   Goto Swissprot  
Score: 133  Expect: 3e-31
nr  BLAST report  
sp|Q26734|PROF_TRYBB PROFILIN emb|CAA96531.1| (Z72391) profilin [Trypanosoma brucei]   Goto GenBank  
Score: 133  Expect: 2e-30
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7986  indefinite