genoma.unsam.edu.ar :: tca :: tca-06a17.b1MT

Sequence

>tca-06a17.b1MT
TACCCACGCGTCCGTGCTGATTCCTGTGCGGTGTTACTCTTGGGGGAAAGTAATTGGTCA
CCTCTACCAGACGTACCAAGAACTGCTTGCTGAGGATTACACGGAGGCAGAGGCTCTTAA
TGCACTCTCTCTCGATCGCATGTGTTGTCGTCGCATGATTCTTTCTCACATTGATCTCGT
CGAGGATTTGCTCCCATACAGTGTACCAGTTGTTGGAACGATGCCACTAATAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O13877|RPBX_SCHPO DNA-DIRECTED RNA POLYMERASES I, II, AND III 8.3 KDA POLYPEPTIDE (ABC10-BETA)   Goto Swissprot  
Score: 82.8  Expect: 5e-16
nr  BLAST report  
sp|O13877|RPBX_SCHPO DNA-DIRECTED RNA POLYMERASES I, II, AND III 8.3 KDA POLYPEPTIDE (ABC10-BETA) pir||T38031 dna-directed rna polymerases i, ii, and iii 8.3 kd polypeptide(abc10-beta).dna-directed rna polymerases i, ii, and iii 8.3 kd polypeptide(abc10-beta) - fission yeast (Schizosaccharomyces pombe) pir||T43545 RNA polymerase chain rpb10 - fission yeast (Schizosaccharomyces pombe) dbj|BAA22805.1| (D89596) RNA polymerase II subunit Rpb10 [Schizosaccharomyces pombe] gb|AAC49842.1| (U80219) RNA polymerases I-III common subunit Rpb10 [Schizosaccharomyces pombe] gb|AAC16895.1| (AF027818) RNA polymerases I, II and III subunit Rpb10 [Schizosaccharomyces pombe] emb|CAB11246.1| (Z98598) dna-directed rna polymerases i, ii, and iii 8.3 kd polypeptide(abc10-beta).dna-directed rna polymerases i, ii, and iii 8.3 kd polypeptide(abc10-beta). [Schizosaccharomyces pombe]   Goto GenBank  
Score: 82.8  Expect: 3e-15
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1441  coding