genoma.unsam.edu.ar :: tca :: tca-06a3.b1MT

Sequence

>tca-06a3.b1MT
TTCCCACTTGTCCGCTCTGCCATTGAGGTGGCGCGCGGCAAGCTCACCAATGTGGATATC
GCCCATAAGGATATCAGGCAAGCGCGTGAGGTGCAACGCATCATGTCGACTCCTGACGGC
CGCTTTCGCTGCCTGGCCACCACCGACACGAGGGCTGCAGGGGCCACCCAGAAAATGGCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P90593|GPDA_TRYBB GLYCEROL-3-PHOSPHATE DEHYDROGENASE [NAD+], GLYCOSOMAL   Goto Swissprot  
Score: 60.8  Expect: 1e-09
nr  BLAST report  
sp|P90593|GPDA_TRYBB GLYCEROL-3-PHOSPHATE DEHYDROGENASE [NAD+], GLYCOSOMAL pir||T48649 glycerol-3-phosphate dehydrogenase (NAD+) (EC 1.1.1.8) [validated] - Trypanosoma brucei emb|CAA61890.1| (X89738) glycerol-3-phosphate dehydrogenase (NAD+) [Trypanosoma brucei]   Goto GenBank  
Score: 60.8  Expect: 9e-09
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1974  coding