genoma.unsam.edu.ar :: tca :: tca-06b10.b1

Sequence

>tca-06b10.b1
CCACGCGTCCGAATAGTTTGGCCGCGGTTGAAGTTGAAATTTAAGGCATGGGTGAGTTGA
GCATCCCACTCAAGGTGCTGTACGATGCAATCGACACGAATATTACTCTGGAAGTAAATA
ACGGTGAGATGTACACGGGTAAACTAAGCAAATTAGAGGATACTATGAATGTAATACTCG
TATCGGCAAAAAAGACAACAAAATCTGGACGAGTCCATGAGCTCAAGAGCGTGTTTATTC
GGGGGTCGACTATTGGGTTTTTTCAACTATCCGATGCTC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P43331|SMD3_HUMAN SMALL NUCLEAR RIBONUCLEOPROTEIN SM D3 (SNRNP CORE PROTEIN D3) (SM-D3)   Goto Swissprot  
Score: 67.0  Expect: 4e-11
nr  BLAST report  
pir||T31498 hypothetical protein Y116A8C.42 - Caenorhabditis elegans emb|CAB55132.1| (AL117204) predicted using Genefinder~contains similarity to Pfam domain: PF01423 (Sm protein), Score=46.2, E-value=2.3e-10, N=1~cDNA EST EMBL:T00187 comes from this gene; cDNA EST yk103h3.3 comes from this gene~cDNA EST yk103h3.5 comes from this gene;>   Goto GenBank  
Score: 70.1  Expect: 3e-11
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1035  coding