genoma.unsam.edu.ar :: tca :: tca-06b6.b1

Sequence

>tca-06b6.b1
CCACGCGTCCGATGTGGAACACGTACAATTTGATCTATATGATCACCAAACGGCGGAAAA
AGCCGCAGAAAAAATCCGAAAACTGTTTCCAGATGGTATAGATGTGCTCGTCAACAATGC
TGGGTTCGCATACAATTTCGATGAAACAAAACCGTTTCATCAGCAGGCAATTGATTCAAT
TAGGCGTAATTATTTTGGCACTGTCTCTCTGTGTGAGGCTTTGAGTCCTATGATCAGGGA
TGGTGGCAGAATGATTAATGTTTCCTCCATGGCAGGAAGTCTTTCAAATATTTCAAGCAG
TGCTCTAGCCACGCGATGGAGGGAATGTAAGACACGTGAAGATATTGAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P48758|DHCA_MOUSE CARBONYL REDUCTASE [NADPH] 1 (NADPH-DEPENDENT CARBONYL REDUCTASE 1)   Goto Swissprot  
Score: 101  Expect: 1e-21
nr  BLAST report  
gb|AAH12714.1|AAH12714 (BC012714) Similar to carbonyl reductase 1 [Mus musculus]   Goto GenBank  
Score: 104  Expect: 1e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.023  coding