genoma.unsam.edu.ar :: tca :: tca-06c15.b1MT

Sequence

>tca-06c15.b1MT
CCACGCGTCCGGCGCTGCCAAGCGTGGTTTGATTGGTTTTATCAAAGTACTCACACTTAA
CCCTGCAACAACAAGATTGTGCAGTGCAGTTTGCATTGGATTTGCGTACATGCCTTTGGT
GGAAGATCAGATAGTTCCGACTGCTAAAATCAAACCTGGCGGTGACAAAGAAGCTGCACA
ACGTGTATTGCTTATGTAAAAGCAGCCGTCCCAAGTAGTACTTAATA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9X6U2|BDHA_ALCEU D-BETA-HYDROXYBUTYRATE DEHYDROGENASE (BDH) (3-HYDROXYBUTYRATE DEHYDROGENASE) (3-HBDH)   Goto Swissprot  
Score: 54.7  Expect: 2e-07
nr  BLAST report  
gb|AAF75282.1|AF271714_1 (AF271714) beta-hydroxybutyrate dehydrogenase [Pseudomonas sp. GM101]   Goto GenBank  
Score: 65.1  Expect: 7e-10
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0091  coding