genoma.unsam.edu.ar :: tca :: tca-06d4.b1

Sequence

>tca-06d4.b1
CCACGCGTCCGGTACTATATTGCGATTTTTTTTAGCTTCATACGTGCTAACGAAATATGA
CTATTACTGAAGACATTCTTCGCAAGCGCGCCGAGTTTGTCCGCACTGGTGGGCGTGGCT
CTGTCCGTCGTACGGTGAAAGCCCCGCATCGCAACACGGGTGATGAGAAGAAAGTGCAGG
GTGTTCTTAAACGCTTGGGTGTCTCGCCCTTTAGTGAAATTGACGAAGTCGTTTTTTACC
GCCAGGACGGATCCGCCCTTTACTTTGAGAAGCCGAAGGTTCAGGCGTCAATGCAATCGC
AGTGCTTTGTTGTTTCTGGAGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q64152|BTF3_MOUSE TRANSCRIPTION FACTOR BTF3 (RNA POLYMERASE B TRANSCRIPTION FACTOR 3)   Goto Swissprot  
Score: 58.9  Expect: 1e-08
nr  BLAST report  
ref|XP_032524.1| basic transcription factor 3 [Homo sapiens]   Goto GenBank  
Score: 58.9  Expect: 7e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9836  coding