genoma.unsam.edu.ar :: tca :: tca-06h12.b1

Sequence

>tca-06h12.b1
CCACGCGTCCGGTTTCTGTACTATATTGTTTCCTTCGCTTTTATTCTCAAACTCCGTCGC
TCAGAACACTATGGCCACTCCCAAGAGCTCGTCCGCAAAGCGCGCCAAGGGCGGCAAGTC
GTCGCACCGCAAGCCCAAGCGCTCGTGGAACGTCTACATCAACAGGTCCCTCAAGGCCAT
CAACAAGCAGATGTCCATGTCGGGTCGCACAATCAAGATTATGAATTCGTTTATCAATGA
TATATTCGAGCGCATCGCCAGCGAGGCGGCGACGATTGTGCGCC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P27795|H2B_TRYCR HISTONE H2B   Goto Swissprot  
Score: 141  Expect: 1e-33
nr  BLAST report  
sp|P27795|H2B_TRYCR HISTONE H2B pir||S15721 histone H2B - Trypanosoma cruzi pir||S54703 histone H2b - Trypanosoma cruzi emb|CAA43297.1| (X60982) histone H2b [Trypanosoma cruzi]   Goto GenBank  
Score: 141  Expect: 8e-33
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1156  coding