genoma.unsam.edu.ar :: tca :: tca-06i23.b1

Sequence

>tca-06i23.b1
CCACGCGTCCGGAAGAAGTGGCGGCGCTGGAAGCCAAGAAGCAGAAGGATGCCGATGCCA
AGAAGGCCAAGAAGGCTATCATCGCCAAGTCGTCCATCCTCTTTGACGTCAAGCCCTGGG
ATGACACCATTGATCTCGAGGCACTTCGCAAGAAGCTGCACGCGATCCAGCGCGACGGCC
TGCTGTGGGGCGACCACAAACTGGTGCCAGTGGCATTCGGCGTGGAACAAAATCTAATCA
GAGATGATGAGCATATTTTTAATAAAAGAAAATACGACAAATTATTATACGTAATAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P34827|EF1B_TRYCR 25 KD ELONGATION FACTOR 1-BETA (EF-1-BETA)   Goto Swissprot  
Score: 90.9  Expect: 2e-18
nr  BLAST report  
sp|P34827|EF1B_TRYCR 25 KD ELONGATION FACTOR 1-BETA (EF-1-BETA) gb|AAA67700.1| (L12584) elongation factor 1-beta [Trypanosoma cruzi]   Goto GenBank  
Score: 90.9  Expect: 1e-17
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2759  coding