genoma.unsam.edu.ar :: tca :: tca-06j19.b1MT

Sequence

>tca-06j19.b1MT
CCACGCGTCCGGTTTCTGTACTATATTGACAAGTTCATTCAGATACTTTTCACAAGAATA
GCAATCTTTATTCCACAAACACAAACACAAACCCAAGCAGTGAAGAATGTCCAAGGGGAA
GAAGTCCGGCGAGGCGAAGGGCATGCA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P08436|H4_VOLCA HISTONE H4   Goto Swissprot  
Score: 84.0  Expect: 3e-16
nr  BLAST report  
gb|AAD50306.1|AF175386_1 (AF175386) histone H4 [Leishmania tarentolae]   Goto GenBank  
Score: 102  Expect: 5e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9617  coding