genoma.unsam.edu.ar :: tca :: tca-06k7.b1

Sequence

>tca-06k7.b1
CCACGCGTCCGGCACCCTATGAATAGTCGTGCAGATTATCGTAGAGAGCAATTTGCTTCT
AGCGGCGGTGCTCATTCTATGCAAAGTCTTCGTGATGACATTTTTGATGATTATAGGGTT
GTTCGTCATATCAAAGATGCTCCACCTGTTATTATTCATTCCATTTCTCCTCAAAATGCC
TTTAAAGAGGCTCAAATAATTCTTCGCTATGATCCTGACGTACCGAGCAGTCTATCTGAA
TCACCTATCGATGTCGAGCAAGTCATACGGAAAGTGACTGAAGTCCATGAAACAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAG26324.1| (AF213249) putative spliced leader RNA PSE-promoter transcription factor PPB1 [Trypanosoma cruzi]   Goto GenBank  
Score: 213  Expect: 3e-54
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1041  coding