genoma.unsam.edu.ar :: tca :: tca-06o13.b1

Sequence

>tca-06o13.b1
CCACGCGTCCGCCCCGAGAACCCTAAAGACAGGCACTACTATTGTAGGAGTCGTTTATAA
AGATGGTGTGGTTTTAGGAGCCGATACCCGCGCCACCGAAAGTAACATTGTAGCAGACAA
GCGCTGCAAGAAAATTCACTACATGGCGCCAAACATTATGTGCTGTGGTGCTGGAACAGC
AGCTGACACTGAGGCTGTTACAAATATGGTAGCCGCCAATCTTGCACTTCATCGTCTTGA
GACTGGGAAGCAATCGCGCGTGCAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q09841|PRCF_SCHPO PUTATIVE PROTEASOME COMPONENT PUP1 PRECURSOR (MACROPAIN SUBUNIT) (MULTICATALYTIC ENDOPEPTIDASE COMPLEX SUBUNIT)   Goto Swissprot  
Score: 118  Expect: 1e-26
nr  BLAST report  
gb|AAG16286.1|AC016024_9 (AC016024) leishmania proteasome subunit beta-2 [Leishmania major]   Goto GenBank  
Score: 169  Expect: 5e-41
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1676  coding