genoma.unsam.edu.ar :: tca :: tca-07c22.b1

Sequence

>tca-07c22.b1
AGCCTCAATTTTATCGTCCGGAGACGACAGCAACTCGACCCTTCGGTGGCATGACGACTG
GAGTTTCAGAACGCGGTGCGCCGTGGGGCACGCAAACCAGTCCTTCACTTGACACAGTTA
ATTGGTCTCTTCAGGATCGATATCAGAGACCTTCTCATCAAGGAATTCACTATAATTCGT
ATGGAGCACTGGGACAGCAGCAGCAACAACGATCATATGTTCCAATACCGGCGAACAGGG
TGCGACAACATGAAATGATGTCGGATGCTTCTTTGCGTGCTCTGCGTGATGGAGGAGTTA
CTGGGACTTTTAATCGTCACCC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAB69754.1| (U67927) TC38 [Trypanosoma cruzi]   Goto GenBank  
Score: 125  Expect: 5e-28
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9459  indefinite