genoma.unsam.edu.ar :: tca :: tca-07d17

Sequence

>tca-07d17
CCACGCGTCCGATATTGAAAGCTTTACATCTATTTTTTTTTTCTACATTCTCACACATCC
AACACATGTTCCGTGTTACTGTTCCCGCACTGAAGAAACTGCAGCCGTTGGGCCAGCGTG
TCCTCGTGAAGCGCACCCAGGCGGCGAAGCAGACGAAGGCCGGCGTGCTGATCCCCGAGC
AGGTTGCGGGGAAGGTCAACGAGGGGACTGTGGTCGCCGTCGCGGCGGCGTCGAAGGACT
GGACGCCTACAGTGAAGGTCAACGACACAGTGCTGCTCCCAGAGTTCGGCGGGAGCAGTG
TGAAGGTGGAGGGCGAGGAGCTGTTCCTGTACAATGAGGAGTCCATCCTCGGCATTTTGG
AGAACTGATACTCTGGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q04984|CH10_HUMAN 10 KDA HEAT SHOCK PROTEIN, MITOCHONDRIAL (HSP10) (10 KDA CHAPERONIN) (CPN10)   Goto Swissprot  
Score: 75.9  Expect: 9e-14
nr  BLAST report  
gb|AAK77863.1|AF394959_1 (AF394959) co-chaperonin CPN10 [Leishmania donovani]   Goto GenBank  
Score: 166  Expect: 4e-40
trypEST  BLAST report  
gb|AI069682.1|AI069682 TENU2726 T. cruzi epimastigote normalized cDNA Library Trypanosoma cruzi cDNA clone 26o19 5' similar to 10 KD HEAT SHOCK PROTEIN, MITOCHONDRIAL (HSP10) sp|Q04984|CH10_HUMAN, mRNA sequence   Goto GenBank  
Score: 218  Expect: 6e-57

Testcode evaluation

Score  Evaluation  
1.2068  coding