genoma.unsam.edu.ar :: tca :: tca-07h17.b1MT

Sequence

>tca-07h17.b1MT
TGGGAGGATTATGACAAACTTGAAATCGAAGCAGCGTGTCGTGACTCTGGCAAACAGCAT
CAGGAAGGTCGTAATTATGAGGTTCAGGACGGTGATATCATTTTTTTCAAATTCAATACT
TCAAAGGGTGGTAAAAAATAAAAAAAATGAAATGATAATTATTCTTCTTTTTGAAAAGAA
AAGATAATAATAACTATTGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAF66088.1| (AF110663) putative GTP-binding protein [Leishmania major]   Goto GenBank  
Score: 79.0  Expect: 3e-14
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0664  coding