genoma.unsam.edu.ar :: tca :: tca-07j21.b1MT

Sequence

>tca-07j21.b1MT
CCACGCGTCCGGCATAATTCGACAATCACACAACGTCAGCCAGGCGAATTTTTTCGTCGT
ATCCGCACAAAAACCATTGCAGAGAATATTATTCAACGCAAGCGTTGCATGGAAATGGTA
AACAACAAACCTAGTGATGGTGGCTTTGCTCACCCCATGGACGAGTATCGTGAACCAAAC
GCAAAACCAGAAAAGGAATATCTCATTCTTGATGTGCGCTCCGAAGAGGATTATGCGGCA
TGCCATATTATTGGAGCACTTCATTATCCGAGGCGTAAGCTTTTGCACGCAACCAATACA
TTCCTACCGGAGATGTTCGCATTCAAGAATAAAGAGAATAAAACTATCGTGCTTTACGAT
CTGGAAGAAGAGAAAACTGTTGGCGAGAATGTTGGAAATATTGTTTTTGAAAAAGGTGT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
ref|NP_114387.1| testis specific gene A13 [Mus musculus] emb|CAC33579.1| (AJ278891) testis specific protein a14 [Mus musculus]   Goto GenBank  
Score: 72.8  Expect: 3e-12
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1073  coding