genoma.unsam.edu.ar :: tca :: tca-07l2.b1

Sequence

>tca-07l2.b1
CCACGCGTCCGGGGAATACGGAAATGCCCGCTAAAGCCGCCGCGAAGGCCCCTGCGCCAA
AAGCTGCCCCCAAAGCCGCTGCAAAGGCCGCGCCAAAGGCCGCCCCAAAGGCCCCGGCGA
AGGCCCCCCCAAAGGCCCCGGCGAAGGCTGCGCCCAAGCCGGCATCCCCGAAGGAGACAA
AGCCCCGCGCCGCCGCCGGTAGCCAGAATGGCGTGTACGTGAAGAACTGGGGCCAGGGCT
CCGTGAGCGACGCGAAGACCATCTTCAGCGCGGCCGGAAACGTCACCGCTGTGCAGATCC
GTCG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAB81432.1| (AF020695) RNA binding protein [Trypanosoma brucei]   Goto GenBank  
Score: 163  Expect: 4e-40
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.3218  coding