genoma.unsam.edu.ar :: tca :: tca-07l21.b1

Sequence

>tca-07l21.b1
CCACGCGTCCGGTTTCTGTACTATATTGGTTCTTTAAGAAGCATGCAGATCTTTGTGAAG
ACGCTCAGGGGCAAGACAATCGCCCTCGAGGTCGAGGCCAGTGACACGATCGAGAATGTG
AAGGCGAAGATCCAGGACAAGGAGGGTATCCCCCCGGACCAGCAGCGCCTGATTTTCGCC
GGCAAGCAACTGGAGGAGGGCCGCACGCTGGCGGACTACAACATCCAGAAGGAGTCCACA
CTGCACCTTGTGCTTCGCCTGCGCGGTGGCGTGATGGAGCCGACGCTTGAGGCCCTTGCG
AAGAAGTTCAATTGGGAAAAG


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL499621.2|LMFLCHR31 Leishmania major chromosome 31 clone Chr.31 strain Friedlin, *** SEQUENCING IN PROGRESS ***, in ordered pieces   Goto GenBank  
Score: 398  Expect: 1e-110
sp  BLAST report  
sp|P15174|UBIQ_TRYBB UBIQUITIN   Goto Swissprot  
Score: 147  Expect: 2e-35
nr  BLAST report  
pir||C48111 ubiquitin / ribosomal protein CEP52 - Trypanosoma brucei emb|CAA39863.1| (X56511) ubiquitin EP52/1 [Trypanosoma brucei] emb|CAA39864.1| (X56511) ubiquitin EP52/2 [Trypanosoma brucei] emb|CAA38453.1| (X54641) EP52; ubiquitin [Trypanosoma brucei] emb|CAA38454.1| (X54642) ubiquitin; EP52 [Trypanosoma brucei]   Goto GenBank  
Score: 248  Expect: 5e-65
trypEST  BLAST report  
gb|AI075604.1|AI075604 TENU3026 T. cruzi epimastigote normalized cDNA Library Trypanosoma cruzi cDNA clone 28h21 5' similar to Trypanosoma cruzi ubiquitin gene emb|X07451|TCUBI, mRNA sequence   Goto GenBank  
Score: 343  Expect: 1e-94

Testcode evaluation

Score  Evaluation  
1.2466  coding