genoma.unsam.edu.ar :: tca :: tca-07m11.b1

Sequence

>tca-07m11.b1
CCACGCGTTCGGGCAACTTACTTGAAGCCTGCGCACGCCAGCCAAATCTAACCAAGATGC
TCTTTAACTACGCTATTCTTGGCTTTGCCCTTACAGAGGCTATTGGGCTCTTTGCCCTGA
TGCTTGCCTTCCTGATGCTCTTCTCGTAGATTACACGGTGGTAGGCAAACGATGTTGAGG
AAGACATGATTTGGCAGCAGCGATTAGTGGAGTTGGTCAGGTATATAGTATATAGGACGT
GCAGCTGAATGTGTGCTGCCAGGGCTTTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC48310.1| (AF014058) ATPase subunit 9 homolog [Trypanosoma brucei brucei]   Goto GenBank  
Score: 64.7  Expect: 1e-09
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9413  indefinite