genoma.unsam.edu.ar :: tca :: tca-07m17.b1

Sequence

>tca-07m17.b1
TTCCCGGGTCGACCCACGCGTCCGCAAAAGAGAAGCTCCTGCGGAAATGCCATATGTTTG
GAGGCATAATAATGGTTTTACTGTCGAATCTCTTCGTAATGATATGTGGGAAATCATTTT
GGCACATTCAACTGAGCCTGCTTAACTTGTTGGGAGACCAGTGTTGCAGAGCGATCAGCT
TCGTTGAGAAACTGATGAAGAGGTTATCAAGTAAATTCTAATACACTAAGCTGTGCCTGG
GAAGAAACAAAAAAAAACA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAA91142.1| (Z54341) MAP kinase-like protein [Trypanosoma brucei]   Goto GenBank  
Score: 54.7  Expect: 1e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0516  coding