genoma.unsam.edu.ar :: tca :: tca-07m7.b1

Sequence

>tca-07m7.b1
CCACGCGTCCGCTCAAGCGGCGCGCAGCGTATCCACGACCCTGCTCCACTTCTCGAGCGC
GCCAAGTCACTGAACGTTGACCTCACCCCGGTGACTGCGTACGTGGACTCGTTCCGCCTC
GGCGCGTGGCCGCATGGTGGCTTTGGTGTGGGCCTCGAGCGGGTTGTGATGCTCTATCTT
GGGTTGCACAATGTACGCCTCGTTTCGCTTTTTCCACGTGACCCGCAGCGCGTCACACCA
TGAGTAGGGAGAGACGAGTAGATTATGTGTGCCATTCCCTTTTTTCTTTTTCTTTTTCTT
TTTTTTTTTTGG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P15178|SYD_RAT ASPARTYL-TRNA SYNTHETASE (ASPARTATE--TRNA LIGASE) (ASPRS)   Goto Swissprot  
Score: 106  Expect: 5e-23
nr  BLAST report  
gb|AAH08638.1|AAH08638 (BC008638) Similar to aspartyl-tRNA synthetase [Mus musculus]   Goto GenBank  
Score: 106  Expect: 3e-22
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8885  indefinite