genoma.unsam.edu.ar :: tca :: tca-07n22.b1

Sequence

>tca-07n22.b1
CCACGCGTCCGAGACCCGCAAAATTGATGAAGTCATTCGCGTTGACCAAGCATGTGAGGT
ATCTGCTGTAAGAATTTGTCGAAATCAGCTCTTTTGGATTTCCCCACTTCACCCATCTGT
ACCTGTTATACGGGAAATTCTCGAAGATGAATTGATTCATGAAAAAACAATGAATGATCT
CGCCAGAAAGCACGATGTTAAGCTTACATCTTTAGATCCACTTTTTAATCTTGGTGCGTT
TGCTATGGGTTCCATAACCGCTTTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P41735|CAT5_YEAST CAT5 PROTEIN (UBIQUINONE BIOSYNTHESIS PROTEIN COQ7)   Goto Swissprot  
Score: 83.2  Expect: 5e-16
nr  BLAST report  
ref|NP_014768.1| may encode a protein involved in one or more monoxygenase or hydroxylase steps of ubiquinone biosynthesis; Cat5p [Saccharomyces cerevisiae] sp|P41735|CAT5_YEAST CAT5 PROTEIN (UBIQUINONE BIOSYNTHESIS PROTEIN COQ7) pir||S49912 CAT5 protein - yeast (Saccharomyces cerevisiae) emb|CAA58105.1| (X82930) CAT5 [Saccharomyces cerevisiae] emb|CAA62119.1| (X90518) putative [Saccharomyces cerevisiae] emb|CAA64044.1| (X94335) YOR3284c [Saccharomyces cerevisiae] emb|CAA99324.1| (Z75033) ORF YOR125c [Saccharomyces cerevisiae] gb|AAB36435.1| (S81938) COQ7 [Saccharomyces cerevisiae]   Goto GenBank  
Score: 83.2  Expect: 3e-15
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9385  indefinite