genoma.unsam.edu.ar :: tca :: tca-08a21.b1

Sequence

>tca-08a21.b1
CCCCGTCGAGGCTGAAACATACATGGTGCGCGGAAACAACATTCGATACATCATTCTCCC
AGAGGCACTGAACACAGATAATGTCCTTAAGAAAGCCACCACTGCGCGCAATAAGCCCGC
AAATGAATAAAAAAAGCAACAGAAAGCTAACTTAGCAGAAACGACACCTTGGACTCTCTT
CAAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAG00461.1|AF280393_1 (AF280393) Sm-D1 [Trypanosoma brucei]   Goto GenBank  
Score: 58.2  Expect: 9e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0408  coding