genoma.unsam.edu.ar :: tca :: tca-08b24.b1

Sequence

>tca-08b24.b1
TTTCCTGTCTGTTCTCAAACGAAGCTAATATGAAGATCTTTAAGGACATCCTGACGAACG
CCGAGGTTGTGTGCGACAATGACAAGCCCTTCGGCATTGAGGGCGGCGTTGTGTACGTTG
TGAAGGGCCGCTACATTGAGATTGGTGGTGAAGATTATGGCATCTCCGCCAACGCGGACG
ACGAAGCCGCTGAAGGCGCCACAGGCGATGTGGACAACGCGAAGCAGCGCGTCATTGATG
TGGTGCACAACAACCGTTACACCGAGACGAACTACTACAAGAGCTCCTACATGGCCCACA
TGCGCGGTTACATGAAGAGAATCCTGGAGAACATTGAGAGCGAGGACGAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P91800|TCTP_SCHJA TRANSLATIONALLY CONTROLLED TUMOR PROTEIN HOMOLOG (TCTP)   Goto Swissprot  
Score: 72.0  Expect: 9e-13
nr  BLAST report  
sp|P91800|TCTP_SCHJA TRANSLATIONALLY CONTROLLED TUMOR PROTEIN HOMOLOG (TCTP) gb|AAB42079.1| (U85483) translationally controlled tumor protein [Schistosoma japonicum]   Goto GenBank  
Score: 72.0  Expect: 5e-12
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2157  coding