genoma.unsam.edu.ar :: tca :: tca-08c7.b1

Sequence

>tca-08c7.b1
CCACGCGTCCGGTTTTATTGGTTTTATCAAAGGACTCACACTTAACCCTGCAACAACAAC
ATTGTGCAGTGCACTTTGCATTGGATTTGCGTACATGCCTTTGGTGGAAGATCAAATAGT
ACCGACTGCTAAAATCAAACCTGGCGGTGACAAAGAAGCTGCGCAACGTGTATTGCTTAT
GTAAAAGCAGCCGTCCCAAGTAGTACTTAATACGGAACAGGGTGGCGATGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAF75282.1|AF271714_1 (AF271714) beta-hydroxybutyrate dehydrogenase [Pseudomonas sp. GM101]   Goto GenBank  
Score: 58.5  Expect: 5e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0413  coding