genoma.unsam.edu.ar :: tca :: tca-08d1.b1

Sequence

>tca-08d1.b1
CCTCGCGTCCGGAAAGAGTACCATCGCGCAAATACACAGCGGGAGGTCCCTGGTGCAAAT
GCTAAGCGCCTCGACGAAGATAGCGAAACCACAAAAGTGAAGCGTATTGACAACAGTCTG
CGTGTTGCCATTCAGCGTGCTCGGCAGGAGAAGAATTGGACTCAGCAGGATCTAGCGCAG
CGTATCGCTGAGCGAGTAGGTGTTGTGACGGAATACGAGAACGGCAAAGCTGTGCCAGAA
GAGCGTGTTTTGGTTAAAATGGAAAAAGCGTTCGGAATTCACTTACGCGGTGCGAAGGCG
GGCCAGCCCTTTGGGAGCACGAAGCCGCAGCCGAAGAAGAGCGTCTGATTCGTCTTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P14327|VSH7_DICDI VEGETATIVE SPECIFIC PROTEIN H7   Goto Swissprot  
Score: 79.7  Expect: 4e-15
nr  BLAST report  
emb|CAB75577.1| (AL139796) possible transcription factor [Leishmania major]   Goto GenBank  
Score: 145  Expect: 4e-34
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1192  coding