genoma.unsam.edu.ar :: tca :: tca-08d15.b1

Sequence

>tca-08d15.b1
ACCATGAAGGCATTTGAAAGTAATTTCAAAATGTCTCACTCCTTTGAAACGCGGCAGAGG
GATGCGGCAAAGGTTCGTGAGCGACATCCTGACCGTGTGCGATTGATTTGCGAAAAAGCA
GATGATTCTGACATCGGTGACCTGGACAAAATCAAGTTTCTTGTGCCGTCCGATCTTACG
ATTGGTCAGTTTATCATGGTGCTCCGCAAACGTGTCCAATTGGAGCCAGAAGACGCCATT
TTTGTCTTTGTGAATGGAAGTGTGCCTCCAACTACAGCTGAAATGTCGGACTTGTACAGT
CGCTTTAAGGACGAGGATGGCTTTTTGTACATCAAATATT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P87068|SYRP_LACBI SYMBIOSIS-RELATED PROTEIN   Goto Swissprot  
Score: 140  Expect: 3e-33
nr  BLAST report  
gb|AAB53650.1| (U93506) symbiosis-related protein [Laccaria bicolor]   Goto GenBank  
Score: 144  Expect: 9e-34
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0105  coding