genoma.unsam.edu.ar :: tca :: tca-08e10.b1

Sequence

>tca-08e10.b1
CCACGCGTCCGGTGCTAACTAAAACCTATTGTATGTGCTTTGACGAGGATAGTGGTGAGG
TTGAGATAGAATCCCTGAAAGCGACTCCCGTCGAGTGGACCTCCCCTGAGAAGAACCTTA
CCGTCGTCATTAAAGTAAAGAAACAGCGCCACCAGAAAACAAACAACATTCGCATTGTGA
AGCGTGAGGAGAAGTGCGATTCCTTCTTCAATCTCTTCACAGACCCTCTTGAAGGCGAGG
ACGACGAGGATGAGGAAGAGGAAGAGGAAAAGGCGGAACTGCACATCGAGGCGGGTCAGC
TCTTCATGGAGGAGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q99733|NPL4_HUMAN NUCLEOSOME ASSEMBLY PROTEIN 1-LIKE 4 (NUCLEOSOME ASSEMBLY PROTEIN 2) (NAP2)   Goto Swissprot  
Score: 58.2  Expect: 1e-08
nr  BLAST report  
pir||T40114 nucleosome assembly protein - fission yeast (Schizosaccharomyces pombe) emb|CAA21169.1| (AL031788) nucleosome assembly protein [Schizosaccharomyces pombe]   Goto GenBank  
Score: 70.9  Expect: 1e-11
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2819  coding