genoma.unsam.edu.ar :: tca :: tca-08g20.b1

Sequence

>tca-08g20.b1
CCACGCGTCCGGCGCCTGTTAATACTTATCAACGCGCGTGTCTTCATCGCCAAAGACAAC
ACAGTGGCACTTCAGCTTGCATTGCGTGGAGCCACCGCGGATCTTCGAGATTATCTCTCC
ACCGCTCTGCTTTCATAGGCCCCTCATTCACACACAACCCACAAAATTGAAATATTAGAA
AGAGGGATACAAGAAAAAGAAGACATATTAAATTTAATCGGATTGTGAAAATGCAGAGAA
AGGGAGGGGAAAACACGGCGCTACCGTCACCTTTTTGTTTTTTACCCCCTACCCTCGCGA
TGAGGCCCCGTGGGCGTACGCACCTATATGAGGATTAAACGCTTTACTCATAAGAATGAC
TTTACCGGGGTGGTTCTGGTTTTTTTTTGGTTTTTTTTGTGCGTGTGCGTGTGTGTATGT
GTGTGTGTGTTTATG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
No hits  
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.6042  noncoding