genoma.unsam.edu.ar :: tca :: tca-08g5.b1

Sequence

>tca-08g5.b1
CCACGCGTCCGATTGCTAGGTGACGTGACCACTTATCTCACAATGGCTCTGAGCATGGTT
TCTTCCGCAGCTATTCGTGCTAACCGCAGCAAGAAGATTCATCAGCTGACGAAGAAGACC
TCAAAGGTCAACCGCAAGCGCAAGGCACCCCGCCTGTACATGAAGGCCACCATGGCCGGC
TACACCCGCGGCCTTCACGGTCAGAATAAGAACACCGCCATCGTGCGCATCGAGAACGTC
AACACGAAGGAAGATGCCACGTGGTACGTCGGCAAGCGTGTGTGCTACGTGTACCACGGC
TACAAGATGAAGCGCTGTGTGCGGTGGTCGAAGGCGCC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P49180|R35A_CAEEL PROBABLE 60S RIBOSOMAL PROTEIN L35A   Goto Swissprot  
Score: 103  Expect: 2e-22
nr  BLAST report  
gb|AAK92169.1|AF400197_1 (AF400197) ribosomal protein L35A [Spodoptera frugiperda]   Goto GenBank  
Score: 107  Expect: 9e-23
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0592  coding