genoma.unsam.edu.ar :: tca :: tca-08g6.b1

Sequence

>tca-08g6.b1
ACGGCAACATTGCCTTCTCTGAGGTCCTTAAGATCGCGAAGGAGGCGCAGCCCAAGTCCA
TGGGCGCCAGCATGAAGGCGGTGGTGATGGAGGTGCTCGGCACTGCTGTCTCCATCGGCT
GCACCATCGATGGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O75000|RL12_SCHPO 60S RIBOSOMAL PROTEIN L12   Goto Swissprot  
Score: 63.5  Expect: 3e-10
nr  BLAST report  
ref|NP_200875.1| 60S ribosomal protein L12 - like [Arabidopsis thaliana] dbj|BAB09840.1| (AB005246) 60S ribosomal protein L12 [Arabidopsis thaliana] gb|AAK62669.1| (AY039614) AT5g60670/mup24_80 [Arabidopsis thaliana]   Goto GenBank  
Score: 75.1  Expect: 6e-13
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.3134  coding