genoma.unsam.edu.ar :: tca :: tca-08h15.b1.GL

Sequence

>tca-08h15.b1.GL
CCACGCGTCCGCTATATTGGAAATCTATCCACCGGTGCATTCGCAATGGGACGCTTTAAG
CCGCTTGCCGTTAAGAAGAAGTATGCGAAGAAACTGAACCAGAACCGACCTGTACCTTAC
TGGATCCGCCTTCGCACAGGCAACCGAATCAAGTGGAACGATAAGCGCCGCCACTGGCGC
CGCACGAAGTTGCACTACTAAGCGCAACGAAAGAGACGGAGAGAGAGAGTGCAAAAAGGA
TAGAACTCGTCAAGAAAGCCTCTTCTGTTTCTCCGTTGCATTCCAGAAGATAATGTAATG
CCGGTGGACCTCCGCTTGTGATCTTTTTTGTTTCTTTCGTATTCGCTCGCATATGTTCTT
TTTTTTGATGAGTCGCCTCTACTGTTGACGAGGCTCACTAGAATATATGTGTTCGTTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P51425|RL39_MAIZE 60S RIBOSOMAL PROTEIN L39   Goto Swissprot  
Score: 61.2  Expect: 2e-09
nr  BLAST report  
gb|AAK95168.1|AF401596_1 (AF401596) ribosomal protein L39 [Ictalurus punctatus]   Goto GenBank  
Score: 61.2  Expect: 1e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7475  indefinite