genoma.unsam.edu.ar :: tca :: tca-08h15.b1

Sequence

>tca-08h15.b1
ATCCACTGGTGCATACGCAATGGGACGCTTTAAGCCGCTTGCCGCTAAGAAGAAGTATGC
GAAGAAACTGAACCAGAACCGACCTGTACCTTACTGGATCCGGCTTCGCACAGGCAACCG
AATCAAGTGGAACGATAAGCGCCGCCACTGGCGCCGCACGAAGTTGCACTACTAAGCGCA
ACGAAAGAGACGGAGAGAGAGAGTGCAAAAAGGATAGAACTCGTCAAGAAAGCCTCTTCT
GTTTCTCCGTTGCATTCCAGAAGATAATGTAATGCCGGTGGACCTCCGCTTGTGATCTTT
TTTGTTTCTTTCGTATTCGCTCGCATATGTTCTTTTTTTTG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P51425|RL39_MAIZE 60S RIBOSOMAL PROTEIN L39   Goto Swissprot  
Score: 62.0  Expect: 1e-09
nr  BLAST report  
sp|P51425|RL39_MAIZE 60S RIBOSOMAL PROTEIN L39 pir||T03943 ribosomal protein L39 - maize emb|CAA64728.1| (X95458) ribosomal protein L39 [Zea mays]   Goto GenBank  
Score: 62.0  Expect: 9e-09
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7509  indefinite