genoma.unsam.edu.ar :: tca :: tca-08h20.b1.GL

Sequence

>tca-08h20.b1.GL
CCACGCGTCCGCGAAGAACGAAAAATATAATTTGCATAAAAAAAATGTTTTTTTCTGATT
TGAAGTATAAGAGAAAAGAAGGGATGAGGTCAGGAAGAGAACAGACAACATTTTTGCCTG
GTTAGGATTTCTTGATGCTTACTTTCCCCTAAAGCGTAATTTTCACGATCTGATAATGGA
TGTTGCTATTGTTTTTATTGTTTAAAACGAGGGTTCGAATTTTCTTTTATCATGCTTCTT
ACCTTGCTCGTTTATTTATTCATCGTTGCCCTTGATGCCCGCTCCCTGCAGGCTGTAACG
TATGATCCCAAATGTTCGGGCAGCCCAAACG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
No hits  
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.6071  noncoding