genoma.unsam.edu.ar :: tca :: tca-08h6.b1.GL

Sequence

>tca-08h6.b1.GL
AAAAAACAAAGGATCGTATTCAAAAGCGAGAACAAACTCTTGCGCAACAATTTTCTGATC
AAGTCGAAGATTATCGTGTAAAGCTTCGTGAACTTAACAGTTCTCAGGATTCAGCAAGCA
TGGCGAGTCAGAATGTCCAAGAACTTTCAGCGGAGCTAAATCAGGTAAGTGGTCTGCTAG
ATCAGGTCAAGCGAGATATTGAAGAGAGAGAAGCCAAAATATCAGATACAACTCCCTTAA
TGCAAGTAAAGGATGTCGTGGTGAAAGTACGAGCCGAGATAAAACAAATGTCATTGAGAA
TCGGTGTATTGCAACATACAGTCCTTCATTATGTAATGAAACAAACAAAAGCCAAACGTG
AGTGGCCTGATTATCATCTAGAGCAAGAAGAAATGGATGAGTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAK69403.1|AF274590_1 (AF274590) huntingtin-interacting protein-1 protein interactor [Mus musculus]   Goto GenBank  
Score: 73.9  Expect: 3e-12
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2024  coding