genoma.unsam.edu.ar :: tca :: tca-08h7.b1

Sequence

>tca-08h7.b1
CCACGCGTCCGCACTAATGTGGAGGGCAAGCGCTAGGTCCCCTTCGCACTTCGCATGGTG
AAGGGTATCGGCATTCGCTTCGCGTACATGATTTGCAAGAAGGCTGGTGTGGACGTGGAG
CGCCGCGCGGGCACACTGACAACTGACGAGCTCGAGAAGATTTCGGAGATCATCGCTGAC
CCAGCAAAGTTCAAGATCCCCGATTGGTTCCTGAACCGCCAGCGCGACCCCAAGACCGGC
AAGACGGAGCACCTCAGCAGTGCATTAGTCGATACGCGCCTGCGTGACGACCTCGAGCGT
TTGAAGA


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL499624.2|LMFLCHR36 Leishmania major chromosome 36 clone Chr.36 strain Friedlin, *** SEQUENCING IN PROGRESS ***, in ordered pieces   Goto GenBank  
Score: 270  Expect: 1e-71
sp  BLAST report  
sp|P49202|RS18_CHLRE 40S RIBOSOMAL PROTEIN S18   Goto Swissprot  
Score: 168  Expect: 1e-41
nr  BLAST report  
pir||T27228 hypothetical protein Y57G11C.16 - Caenorhabditis elegans emb|CAB16517.1| (Z99281) contains similarity to Pfam domain: PF00416 (Ribosomal protein S13/S18), Score=253.9, E-value=6.8e-73, N=1~cDNA EST EMBL:T01950 comes from this gene; cDNA EST yk60e2.3 comes from this gene; cDNA EST yk75b4.3 comes from this gene; cDNA EST yk77>   Goto GenBank  
Score: 173  Expect: 2e-42
trypEST  BLAST report  
gb|AI065247.1|AI065247 TENU2134 T. cruzi epimastigote normalized cDNA Library Trypanosoma cruzi cDNA clone 18a2 5' similar to 40S RIBOSOMAL PROTEIN S18 sp|P49202|RS18_CHLRE, mRNA sequence   Goto GenBank  
Score: 218  Expect: 7e-57

Testcode evaluation

Score  Evaluation  
1.1652  coding