genoma.unsam.edu.ar :: tca :: tca-08j1.b1.GL

Sequence

>tca-08j1.b1.GL
CGACCCACGCGTCCGCGGACGCGTGGGCCTAGAAGTGTTGACTCTTTTCATTCTGTGCGA
AAGCCGGATTTTCCGGCGTCTTTTGACGAACAACTGCCCTATCAGCCAGTGATGGCCGTG
TAGTGGACTGCCATGGCGTTGACGGGAGCGGGGGATTAGGGTTCGATTCCGGAGAGGGAG
CCTGAGAAATAGCTACCACTTCTACGGAGGGCAGCAGGCGCGCAAATTGCCCAATGTCAA
AACAAATTTAAGGCAGCGGGGGAGATGAGATCCGACCGAGCGATCAATATTCAGGTCTTT
TTAATTATACTTATTTTTATA


BLAST summary (best hit)

trypHTG  BLAST report  
gb|AC092777.2| Leishmania major chromosome 27 clone L975 strain Friedlin, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces   Goto GenBank  
Score: 361  Expect: 3e-99
sp  BLAST report  
No hits  
nr  BLAST report  
No hits  
trypEST  BLAST report  
gb|AI046218.1|AI046218 TENU1305 T. cruzi epimastigote normalized cDNA Library Trypanosoma cruzi cDNA clone 19j15 3' similar to T.cruzi small subunit ribosomal RNA gene emb|X53917|TCSSRRNA, mRNA sequence   Goto GenBank  
Score: 339  Expect: 2e-93

Testcode evaluation

Score  Evaluation  
0.9837  coding