genoma.unsam.edu.ar :: tca :: tca-08j17.b1

Sequence

>tca-08j17.b1
CCACGAGTCCGGTTTCTGTACTATATTGGACTTACTTTTTCGCAGCCATGTCAGATGATG
AGGGAAACTTTACTCAGGGAACTGAGCAGGTCGGATCGTTGACCTATCCAATCCAAGCCG
GTGCGCTTAAAAAGGGGGGCTATGTGTGCATTAACGGCCGCCCGTGCAAGGTAATTGATC
TTTCTGTTTCAAAGACCGGCAAACATGGTCATGCCAAAGTCAGTATGGTTGCCACAGACA
TTTTCACCGGTAACAGAATGGAAGATCAAGCACCAAGTACGCACAATGTAGAGGCTCCTT
TTGTGAAAACAGCAACGTACAGTGTACTTGATATTC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P19211|IF51_YEAST INITIATION FACTOR 5A-1 (EIF-5A) (EIF-4D) (HYPUSINE CONTAINING PROTEIN HP1)   Goto Swissprot  
Score: 137  Expect: 2e-32
nr  BLAST report  
emb|CAB95733.1| (AJ278539) eukaryotic initiation factor 5a [Leishmania infantum]   Goto GenBank  
Score: 209  Expect: 3e-53
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1605  coding