genoma.unsam.edu.ar :: tca :: tca-08l21.b1

Sequence

>tca-08l21.b1
TTCGACCCACGCGTCCGCGCCTCGTGTGATTCGCGTGTTGGAATTGAATGACGAGAATTT
CGACAGCATTGTCATGAACCCTGAAAAAGATGTATTTGTTCTTTACTGTGTGAAGTGGTC
TCGGCAATGCAAAACAATGTATAAACTTTGGGATGACCTTTCAATAAGTCAGTCCAAAAA
GCGCAATGCCGCTACGTTCGTCGCCGCGAAAATCGACGGCGATGCCTATCCGGGGGTCAT
CAAGCGCATGGGGGTCGACGGTTTCCCTACGATGCGGTACTACACACGGCTGGAAAAACC
TGGAGCATTGGAGTTCAACGGTGGCAGAGAGCTTGCAATCCTGGACACTTTTGTCTTTCA
AACAACATAATGATGTATCCCCTCCATTTATTTATATATATATATATATATATTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q92249|ER38_NEUCR PUTATIVE DISULFIDE ISOMERASE ERP38 PRECURSOR   Goto Swissprot  
Score: 67.4  Expect: 3e-11
nr  BLAST report  
emb|CAC28831.1| (AL513467) probable protein disulfide-isomerase precursor [Neurospora crassa]   Goto GenBank  
Score: 67.4  Expect: 2e-10
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9033  indefinite