genoma.unsam.edu.ar :: tca :: tca-08p18.b1.GL

Sequence

>tca-08p18.b1.GL
CCACGCGTCCGCAAAAAAAGAAAATACACCCATAACCCAAGTATAGCCTTTGGGAAGATG
GAAAAAGAATTGGCAAAGGCTAAAGAGGAGCTGGCTGAACTAAAAAAGGAAATCCTTTAT
CGCGCTGCTGATGCAGAAAATGCACGTCGTATTGGTCGTGAAGATGTTGAAAAGGCAAGG
AAATACGGAATTACTTCGTTCAGCAAAGATATGCTTGAAGTGGTTGATACTCTTGAAAAG
GGAATTGAGGTGATGTCTAATGTTACGGAGGCCGATCTTGAGGCGAATAAACACTTAAGC
ACCATTCACACAGGCGTAAAACTTTCGCTTAAGATATTGCTGAACAATTTGGCCAAACAT
GGAGTTGAGAAGGTGGACGTTCAGGTGGGACACCAATTTGATCCAAACATCCATGATGCG
CTTCTGAAAATCCCTCCTACAGATAAGTTTCCTAGTGGACAGAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P38523|GRPE_YEAST GRPE PROTEIN HOMOLOG PRECURSOR   Goto Swissprot  
Score: 102  Expect: 1e-21
nr  BLAST report  
ref|NP_014875.1| involved in protein import into mitochondria; Mge1p [Saccharomyces cerevisiae] sp|P38523|GRPE_YEAST GRPE PROTEIN HOMOLOG, MITOCHONDRIAL PRECURSOR pir||S41760 heat shock protein MGE1 precursor - yeast (Saccharomyces cerevisiae) dbj|BAA05058.1| (D26059) 'GrpE homologue' [Saccharomyces cerevisiae] emb|CAA55145.1| (X78350) GRPE [Saccharomyces cerevisiae] gb|AAA19253.1| (U09565) Mge1p [Saccharomyces cerevisiae] emb|CAA99452.1| (Z75140) ORF YOR232w [Saccharomyces cerevisiae]   Goto GenBank  
Score: 102  Expect: 6e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1274  coding