genoma.unsam.edu.ar :: tca :: tca-09a6.b1.GL

Sequence

>tca-09a6.b1.GL
CTGGCACGTGTGATCGCATTGGTTTTGATCATTTGCCTTTTCCACAGCGCCGCTGCGGAG
CCGGAGGTGACGGACAAAGTTTACTTCGACATCACCATCGGGGACCAACCGATCGGCCGC
ATTGTGATTGGCCTCTTCGGCAAAGAAGTGCCAAAGACCGCACAGAACTTCAAACAGCTC
GCGACCGGCGAGAGCGGCTTCGGGTATAAAGGGTCCATCTTCCACCGCGTCATCCATAAC
TTCATGATCCAGGGCGGGGACTTTACAAACTTCGACGGAACCGGCGGCAAGTGCATCTAC
GGCGCCCGCTTTGATGATGAGAACTTCAATGTCAAACACTTTGTCGGTGCTCTGTCTATG
GCAAACGCTGGACCGAACTCCAACGGCTCACAGTTTTTTATCACAACAGCGGCAACGCAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P24367|CYPB_CHICK PEPTIDYL-PROLYL CIS-TRANS ISOMERASE B PRECURSOR (PPIASE) (ROTAMASE) (CYCLOPHILIN B) (S-CYCLOPHILIN) (SCYLP)   Goto Swissprot  
Score: 213  Expect: 6e-55
nr  BLAST report  
gb|AAD46565.1|AF158368_1 (AF158368) cyclophilin [Leishmania donovani]   Goto GenBank  
Score: 241  Expect: 7e-63
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2926  coding