genoma.unsam.edu.ar :: tca :: tca-09b15.b1

Sequence

>tca-09b15.b1
TCGACCCACGCGTCCGGTTTCTGTACTATATTGTTTTCATTATTGTTGATTAAGTGTTAC
CTGTTGGCGAAAATATTGAAAGTTATGTCTGAACAGCTTCGTGCGGAGCACTTGCTCATC
AAGTTCAGCGAGAGCCGCAACCCCATCTCGAGGCGGACAGGACAGAGCACTGCGAACGTG
TCGCGCGCGGCTGCTCTGGCGGAGTTAGAGGAGTGGGCCAATAAGATTGCCAGCGGCGCG
ATAACGTTTGAGGAGGCCGTCCAGCAGCGCAGCGACTGCGGCAGTTACGCCAAAGGCGGA
GATTTGGGTTTCTTCTCGAGGGGTGATATGATGAAGCCCTTTGAGGACACAGTGCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q13526|PIN1_HUMAN PEPTIDYL-PROLYL CIS-TRANS ISOMERASE NIMA-INTERACTING 1   Goto Swissprot  
Score: 76.3  Expect: 8e-14
nr  BLAST report  
gb|AAB36960.1| (U78757) PinA [Dictyostelium discoideum]   Goto GenBank  
Score: 79.7  Expect: 5e-14
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1475  coding