genoma.unsam.edu.ar :: tca :: tca-09d1.b1

Sequence

>tca-09d1.b1
TCCCGGTCGACCCACGCGTCGGGTGCAAGCTGGGGTATTGCGCAAGCGTGCAGTTCAAAT
ACTTTGGGGAGAACCTTTTTGTTACAGTTGAGGTCGCAATGCTTTTAGTTTTGGTCGGCC
ATTTTCAGAAAAATATGTCTTTGGCATTGATAGCTCTTGTTATACAGATAATCGCCTTGG
TGACAATGTCCCTTGGTGCTCTTCCTCGTAGTGTGCACGAATGGCTTTTAGGTGTACAGA
TCATTCTTGATATGTGTAGCCGGTTGCCTCAGATTGTGATGAATAATCGGAATAAATCGA
CGGGACAACTTTCGTTTATTACATTTTATTTTGCGTTCATTGGCAAAGTTTCCCGTTTAC
TTACTACTTTTCAGAATGTACCCGTTGAAAAGGGAAGAGACATCATGCTGGCGCAGTTCG
GTACTTCAGTGGGGTTAAATGCTCTGATTCTCACG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9LTI3|MPU1_ARATH MANNOSE-P-DOLICHOL UTILIZATION DEFECT 1 PROTEIN HOMOLOG   Goto Swissprot  
Score: 71.6  Expect: 2e-12
nr  BLAST report  
ref|NP_200755.1| putative protein [Arabidopsis thaliana] sp|Q9LTI3|MPU1_ARATH MANNOSE-P-DOLICHOL UTILIZATION DEFECT 1 PROTEIN HOMOLOG dbj|BAA97482.1| (AB025604) contains similarity to SL15 protein~gene_id:F2O15.15 [Arabidopsis thaliana]   Goto GenBank  
Score: 71.6  Expect: 1e-11
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0295  coding